Available online at www.sciencedirect.com
Veterinary Parasitology 155 (2008) 146–151
Veterinary Parasitology 155 (2008) 146–151
Short communication
Visceral leishmaniasis in captive wild canids in Brazil
Visceral leishmaniasis in captive wild canids in Brazil
A leishmaniose visceral em canídeos silvestres em cativeiro no Brasil
Marcela M. Luppi a, Marcelo C.C. Malta a, Teane M.A. Silva b, Fabiana L. Silva b,Rafael O.C. Motta a, Ildiko´ Miranda c, Roselene Ecco b, Renato L. Santos b,*
a Fundacao Zoo-Botaˆnica de Belo Horizonte, Av. Otacı´lio Negra˜o de Lima 8000, 31365-450 Belo Horizonte, MG, Brazil b Departamento de Clı´nica e Cirurgia Veterina´rias, Escola de Veterina´ria, Universidade Federal de Minas Gerais, Av. Antoˆnio Carlos 6627, 31270-901 Belo Horizonte, MG, Brazil c Laborato´rio de Leishmaniose, Fundac¸a˜o Ezequiel Dias, R. Conde Pereira Carneiro 80, 30510-010 Belo Horizonte, MG, Brazil
Marcela M. Luppi a, Marcelo C.C. Malta a, Teane M.A. Silva b, Fabiana L. Silva b,Rafael O.C. Motta a, Ildiko´ Miranda c, Roselene Ecco b, Renato L. Santos b,*
a Fundacao Zoo-Botaˆnica de Belo Horizonte, Av. Otacı´lio Negra˜o de Lima 8000, 31365-450 Belo Horizonte, MG, Brazil b Departamento de Clı´nica e Cirurgia Veterina´rias, Escola de Veterina´ria, Universidade Federal de Minas Gerais, Av. Antoˆnio Carlos 6627, 31270-901 Belo Horizonte, MG, Brazil c Laborato´rio de Leishmaniose, Fundac¸a˜o Ezequiel Dias, R. Conde Pereira Carneiro 80, 30510-010 Belo Horizonte, MG, Brazil
Received 31 January 2008; received in revised form 14 March 2008; accepted 21 April 2008
__________________________________________________________________
Abstract
Visceral leishmaniasis (VL) is endemic in Belo Horizonte (State of Minas Gerais, Brazil). Leishmania sp. can naturally infect several species of mammals, and the domestic dog is the most important reservoir of the disease in South America. This report describes five cases of visceral leishmaniasis in Brazilian canids. Among 15 animals kept in captivity in a zoo in Belo Horizonte (State of Minas Gerais, Brazil), two animals, a bush dog (Spheotos venaticos) and a hoary zorro (Lycalopex vetulus) were serologically positive and developed clinical signs of VL, whereas three other canids, including a crab-eating fox (Cerdocyon thous), a maned wolf (Chrysocyon brachyurus), and a hoary zorro (Lycalopex vetulus) had positive serological results without clinical signs. # 2008 Elsevier B.V. All rights reserved.
Visceral leishmaniasis (VL) is endemic in Belo Horizonte (State of Minas Gerais, Brazil). Leishmania sp. can naturally infect several species of mammals, and the domestic dog is the most important reservoir of the disease in South America. This report describes five cases of visceral leishmaniasis in Brazilian canids. Among 15 animals kept in captivity in a zoo in Belo Horizonte (State of Minas Gerais, Brazil), two animals, a bush dog (Spheotos venaticos) and a hoary zorro (Lycalopex vetulus) were serologically positive and developed clinical signs of VL, whereas three other canids, including a crab-eating fox (Cerdocyon thous), a maned wolf (Chrysocyon brachyurus), and a hoary zorro (Lycalopex vetulus) had positive serological results without clinical signs. # 2008 Elsevier B.V. All rights reserved.
Keywords: Leishmania; Leishmaniasis; Cerdocyon thous; Chrysocyon brachyurus; Lycalopex vetulus; Spheotos venaticos
ResumoA leishmaniose visceral (LV) é endêmica em Belo Horizonte (Estado de Minas Gerais, Brasil). Leishmania sp. pode naturalmente infectar várias espécies de mamíferos, e que o cão doméstico é o mais importante reservatório da doença na América do Sul. Este relatório descreve cinco casos de leishmaniose visceral em canídeos brasileiros. Entre os 15 animais mantidos em cativeiro em um zoológico de Belo Horizonte (Estado de Minas Gerais, Brasil), dois animais, um cachorro de Bush (Spheotos venaticos) e um zorro hoary (Lycalopex vetulus) foram sorologicamente positivos e desenvolveram sinais clínicos de VL, enquanto três outros canídeos, incluindo um cachorro-do-alimentares (Cerdocyon thous), um lobo-guará (Chrysocyon brachyurus), e um zorro hoary (Lycalopex vetulus) tiveram resultados sorológicos positivos, sem sinais clínicos. # 2008 Elsevier B. V. Todos os direitos reservados.
__________________________________________________________________
Visceral leishmaniasis (VL) is a chronic and often fatal disease, caused by a protozoan of the genus Leishmania (Leishmania chagasi in the New World).
This protozoon is an obligatory intracellular parasite of monocytes and macrophages in lymphoid organs such as spleen, liver, lymph nodes, and bone marrow (Grimaldi and Tesh, 1993).
This protozoon is an obligatory intracellular parasite of monocytes and macrophages in lymphoid organs such as spleen, liver, lymph nodes, and bone marrow (Grimaldi and Tesh, 1993).
The American VL is considered a zoonosis since the domestic dog is the major reservoir of the disease in urban areas (Bevilacqua et al., 2001; Diniz et al., 2008).
The cycle of these parasites includes the amastigote stage in vertebrate hosts and the promastigotes in the invertebrate hosts (Grimaldi and Tesh, 1993; Palatnikde-Sousa et al., 2001). In Brazil, VL is transmitted by
the phlebotomine Lutzomia longipalpis (Barata et al., 2005), although transmission in the absence of the vector may also occur (Diniz et al., 2008).
In Belo Horizonte (State of Minas Gerais, Brazil), which is a large metropolitan area, VL is considered an endemic disease of great importance to public health (Silva et al., 2001). Leishmania sp. can naturally infect
several mammalian species, whereas canids are the most frequent reservoirs in South America (Palatnik-de- Sousa et al., 2001). The domestic dog (Canis familiaris) plays an important role as a reservoir of VL, allowing the urban cycle of the disease in the presence of the phlebotomies vector (Diniz et al., 2008). In a wild environment, many species can serve as reservoirs of the parasite, but usually these species are not responsible for transmission to humans. There are reports of infection in wild canids such as the crabeating fox (Cerdocyon thous), the maned wolf (Chysocyon brachyurus), the hoary zorro (Lycalopex vetulus) (Curi et al., 2006; Sherlock, 1996), and bush dog (Spheotos venaticus) (Figueiredo et al., 2008).
Other wild mammals including the agouti (Dasyprocta agouti), white-eared opossum (Didelphis albiventris), wild rats (Cercomys cunicularius), and mouse-of-rice (Orysomis eliurus) can also be naturally infected (Sherlock, 1996). However, only Cerdocyon thous is considered a reservoir of VL in Brazil (Courtenay et al., 1996), and the significance of other wildlife species as reservoirs is still debatable (Diniz et al., 2008).
Environmental changes due to destruction of ecosystems associated with migration of human population into the periphery of urban areas have favored urbanization of VL (Patz et al., 2000; Silva et al., 2001; Diniz et al., 2008).
In April 2004, an adult female bush dog (Spheotos venaticus), kept in captivity at the Fundac¸a˜o Zoo-Botaˆnica (FZB) of Belo Horizonte, developed progressive weight loss, vomiting, diarrhea, anemia, polyuria, polydipsia associated with an increase of blood urea (138 mg/dL) and creatinine (3 mg/dL).
Based on a presumptive diagnosis of hemoparasitosis, the animal was treated with doxycycline (5 mg/kg twice a day) and oral fluid therapy, but she developed ascites, cervical edema, and progressed to death 8 days after the beginning of treatment. At necropsy, emaciation, pale mucous membranes and muscles, and diffusely distributed cutaneous hemorrhages were observed. There was a moderate amount of hemorrhagic fluid in the thoracic cavity, the lungs were heavy and congested, and there were suffusions on the endocardium extending to the myocardium. In the abdominal cavity, there was accumulation of moderate amount of fluid with mild fibrin deposition. The intestinal wall was diffusely thickened with mucosal hemorrhage and hemorrhagic intestinal contents. Moderate splenomegaly and renal congestion were also observed. Fragments of tissues were fixed in formalin, processed for paraffin embedding, cut and stained with hematoxylin and eosin.
Histologically, there was a portal lympho-plasmohistiocytic inflammatory infiltrate in the liver (Fig. 1A).
The spleen and lymph nodes had a mild lymphoid hyperplasia. There was marked thickening of the basal
membrane of glomeruli and mesangial cell proliferation, with a moderate lymph-plasmo-histiocytic periglomerular inflammatory infiltrate characterizing a membranoproliferative glomerulonephritis (Fig. 1B).
There was also a mild pulmonary edema, mild myocarditis associated with suppurative vasculitis, and a mild diffuse histiocytic enteritis. With exceptionof the heart and adrenal gland, all other examined tissues, including lymph nodes, spleen, liver, kidney, lung, large and small intestine had macrophages
containing intracytoplasmic amastigotes, supporting the histopathological diagnosis of visceral leishmaniasis.
The diagnosis was further confirmed by immunohistochemistry, according to the methodology described by Tafuri et al. (2004). Amastigotes were immunolabeled indicating that they were amastigotes of Leishmania sp. (Fig. 1). In order to have a better characterization of the organism, DNA samples were extracted from paraffin embedded tissues and used for PCR amplification of Leishmania using primers targeting the kDNA minicircle (CTTTTCTGGTCCCGCGGGTAGG and CCACCTGGCCTATTTTACACCA) that are specific for organisms belonging to the donovani complex (Lachaud et al., 2002). PCR reactions were performed under the conditions previously described by Diniz et al. (2005). DNA samples extracted from lymph nodes and spleen were also positive by PCR (data not shown), confirming the diagnosis of VL. Considering that this PCR protocol is specific for Leishmania belonging to the donovani complex (Lachaud et al., 2002) and the geographic distribution of viscerotropic Leishmania species, the disease in this case was caused by Leishmania chagasi.
Following this initial diagnosis, the remaining 14 canids kept in the same or adjacent premises at the same zoological garden were subjected to a serological survey. The group included six hoary zorros (Lycalopex
vetulus), seven maned wolves (Chrysocyon brachyurus), and one crab-eating fox (Cerdocyon thous) (Table 1). Serological assays included indirect immunofluorescence (IFA) and enzyme-linked immunosorbent assay (ELISA) as previously described by Curi et al. (2006). In addition, a collar impregnated with deltamethrin was placed in each one of the canids as a preventive measure. Two hoary zorros, one maned wolf, and one crab-eating fox were serologically positive (Table 1). Considering that these serological tests do not exclude the possibility of cross-reaction with other kinetoplastids, bone marrow aspirates were obtained from the humerus of all seropositive animals, and processed for DNA extraction and PCR.
One of the seropositive hoary zorros (Lycalopex vetulus) (animal 1; Table 1) had an enlarged right cervical lymph node at the time of blood sampling. Intra-cytoplasmic amastigotes were observed in macrophages during cytologic evaluation of fine needle aspirate from this lymph node. This animal developed
ulcerated skin lesions at the base of the tail and members (Fig. 2), associated with anemia, weakness, prostration, and weight loss. Cytologic preparations from ulcerated cutaneous lesions also demonstrated the presence of amastigotes. A Leishmania sp. (donovani complex) specific sequence was amplified from DNA extracted from bone marrow samples. Due to the poor clinical condition and prognosis the animal was euthanatized. At necropsy, the carcass and mucous membranes were pale, the right cervical lymph node was enlarged, and the animal was emaciated and had mild hepatomegaly and splenomegaly. Amastigotes were observed in the cytoplasm of macrophages in the kidneys, lymph nodes, spleen, lungs, liver, and intestines, and there was a membranoproliferative glomerulonephritis.
The cycle of these parasites includes the amastigote stage in vertebrate hosts and the promastigotes in the invertebrate hosts (Grimaldi and Tesh, 1993; Palatnikde-Sousa et al., 2001). In Brazil, VL is transmitted by
the phlebotomine Lutzomia longipalpis (Barata et al., 2005), although transmission in the absence of the vector may also occur (Diniz et al., 2008).
In Belo Horizonte (State of Minas Gerais, Brazil), which is a large metropolitan area, VL is considered an endemic disease of great importance to public health (Silva et al., 2001). Leishmania sp. can naturally infect
several mammalian species, whereas canids are the most frequent reservoirs in South America (Palatnik-de- Sousa et al., 2001). The domestic dog (Canis familiaris) plays an important role as a reservoir of VL, allowing the urban cycle of the disease in the presence of the phlebotomies vector (Diniz et al., 2008). In a wild environment, many species can serve as reservoirs of the parasite, but usually these species are not responsible for transmission to humans. There are reports of infection in wild canids such as the crabeating fox (Cerdocyon thous), the maned wolf (Chysocyon brachyurus), the hoary zorro (Lycalopex vetulus) (Curi et al., 2006; Sherlock, 1996), and bush dog (Spheotos venaticus) (Figueiredo et al., 2008).
Other wild mammals including the agouti (Dasyprocta agouti), white-eared opossum (Didelphis albiventris), wild rats (Cercomys cunicularius), and mouse-of-rice (Orysomis eliurus) can also be naturally infected (Sherlock, 1996). However, only Cerdocyon thous is considered a reservoir of VL in Brazil (Courtenay et al., 1996), and the significance of other wildlife species as reservoirs is still debatable (Diniz et al., 2008).
Environmental changes due to destruction of ecosystems associated with migration of human population into the periphery of urban areas have favored urbanization of VL (Patz et al., 2000; Silva et al., 2001; Diniz et al., 2008).
In April 2004, an adult female bush dog (Spheotos venaticus), kept in captivity at the Fundac¸a˜o Zoo-Botaˆnica (FZB) of Belo Horizonte, developed progressive weight loss, vomiting, diarrhea, anemia, polyuria, polydipsia associated with an increase of blood urea (138 mg/dL) and creatinine (3 mg/dL).
Based on a presumptive diagnosis of hemoparasitosis, the animal was treated with doxycycline (5 mg/kg twice a day) and oral fluid therapy, but she developed ascites, cervical edema, and progressed to death 8 days after the beginning of treatment. At necropsy, emaciation, pale mucous membranes and muscles, and diffusely distributed cutaneous hemorrhages were observed. There was a moderate amount of hemorrhagic fluid in the thoracic cavity, the lungs were heavy and congested, and there were suffusions on the endocardium extending to the myocardium. In the abdominal cavity, there was accumulation of moderate amount of fluid with mild fibrin deposition. The intestinal wall was diffusely thickened with mucosal hemorrhage and hemorrhagic intestinal contents. Moderate splenomegaly and renal congestion were also observed. Fragments of tissues were fixed in formalin, processed for paraffin embedding, cut and stained with hematoxylin and eosin.
Histologically, there was a portal lympho-plasmohistiocytic inflammatory infiltrate in the liver (Fig. 1A).
The spleen and lymph nodes had a mild lymphoid hyperplasia. There was marked thickening of the basal
membrane of glomeruli and mesangial cell proliferation, with a moderate lymph-plasmo-histiocytic periglomerular inflammatory infiltrate characterizing a membranoproliferative glomerulonephritis (Fig. 1B).
There was also a mild pulmonary edema, mild myocarditis associated with suppurative vasculitis, and a mild diffuse histiocytic enteritis. With exceptionof the heart and adrenal gland, all other examined tissues, including lymph nodes, spleen, liver, kidney, lung, large and small intestine had macrophages
containing intracytoplasmic amastigotes, supporting the histopathological diagnosis of visceral leishmaniasis.
The diagnosis was further confirmed by immunohistochemistry, according to the methodology described by Tafuri et al. (2004). Amastigotes were immunolabeled indicating that they were amastigotes of Leishmania sp. (Fig. 1). In order to have a better characterization of the organism, DNA samples were extracted from paraffin embedded tissues and used for PCR amplification of Leishmania using primers targeting the kDNA minicircle (CTTTTCTGGTCCCGCGGGTAGG and CCACCTGGCCTATTTTACACCA) that are specific for organisms belonging to the donovani complex (Lachaud et al., 2002). PCR reactions were performed under the conditions previously described by Diniz et al. (2005). DNA samples extracted from lymph nodes and spleen were also positive by PCR (data not shown), confirming the diagnosis of VL. Considering that this PCR protocol is specific for Leishmania belonging to the donovani complex (Lachaud et al., 2002) and the geographic distribution of viscerotropic Leishmania species, the disease in this case was caused by Leishmania chagasi.
Following this initial diagnosis, the remaining 14 canids kept in the same or adjacent premises at the same zoological garden were subjected to a serological survey. The group included six hoary zorros (Lycalopex
vetulus), seven maned wolves (Chrysocyon brachyurus), and one crab-eating fox (Cerdocyon thous) (Table 1). Serological assays included indirect immunofluorescence (IFA) and enzyme-linked immunosorbent assay (ELISA) as previously described by Curi et al. (2006). In addition, a collar impregnated with deltamethrin was placed in each one of the canids as a preventive measure. Two hoary zorros, one maned wolf, and one crab-eating fox were serologically positive (Table 1). Considering that these serological tests do not exclude the possibility of cross-reaction with other kinetoplastids, bone marrow aspirates were obtained from the humerus of all seropositive animals, and processed for DNA extraction and PCR.
One of the seropositive hoary zorros (Lycalopex vetulus) (animal 1; Table 1) had an enlarged right cervical lymph node at the time of blood sampling. Intra-cytoplasmic amastigotes were observed in macrophages during cytologic evaluation of fine needle aspirate from this lymph node. This animal developed
ulcerated skin lesions at the base of the tail and members (Fig. 2), associated with anemia, weakness, prostration, and weight loss. Cytologic preparations from ulcerated cutaneous lesions also demonstrated the presence of amastigotes. A Leishmania sp. (donovani complex) specific sequence was amplified from DNA extracted from bone marrow samples. Due to the poor clinical condition and prognosis the animal was euthanatized. At necropsy, the carcass and mucous membranes were pale, the right cervical lymph node was enlarged, and the animal was emaciated and had mild hepatomegaly and splenomegaly. Amastigotes were observed in the cytoplasm of macrophages in the kidneys, lymph nodes, spleen, lungs, liver, and intestines, and there was a membranoproliferative glomerulonephritis.
The other seropositive hoary zorro (animal 2; Table 1) was positive by PCR, using DNA samples extracted from bone marrow. However, this animal did not develop clinical signs of VL up to 2 years after the initial serological diagnosis.
The seropositive maned wolf (Chrysocyon brachyurus) (animal 10; Table 1) had multiple chronic ulcerative cutaneous lesions on the tip of the ears.
Cytological evaluation of imprints from these lesions resulted in the identification of amastigotes in macrophages.
The diagnosis of VL was confirmed by PCR.
The seropositive maned wolf (Chrysocyon brachyurus) (animal 10; Table 1) had multiple chronic ulcerative cutaneous lesions on the tip of the ears.
Cytological evaluation of imprints from these lesions resulted in the identification of amastigotes in macrophages.
The diagnosis of VL was confirmed by PCR.
The seropositive crab-eating fox (Cerdocyon thous) (animal 14; Table 1) died prior to bone marrow sampling for PCR. No gross or histopathological changes compatible with VL were observed in thiscase. Therefore, as the diagnosis in this case was based solely on serology, the possibility of a false-positive
result cannot be completely excluded. This animal had a pancreatic nodule, which based on histopathology and an immunohistochemical panel was diagnosed as a malignant insulinoma (Malta et al., 2008).
Several species of birds and mammals are held in captivity at the FZB, and wild and synanthropic animals
can also be found in the same area, including large populations of opossums and pigeons. The presence of these animals, especially birds, represents a risk factor for VL (Diniz et al., 2008) since the main source of nutrition for L. longipalpis is the blood from birds followed by rodents, humans, dogs, opossums, and horses (Dias et al., 2003). Domestic animals such as dogs, cats, cattle, horses, and birds can also be found around the FZB. All these factors contribute to the maintenance of the vector in the environment.
Two vertebrate reservoirs have been identified for human VL in Brazil, the domestic dog and the crabeating fox (Cerdocyon thous) (Deane and Deane, 1962; Courtenay et al., 1996). There is also a report of the occurrence of seropositivity in wild non-captive Cerdocyon thous and Chrysocyon brachyurus in the State of Minas Gerais, Brazil (Curi et al., 2006). A study based on xenodiagnosis, demonstrated that the rate of transmission of Leishmania infantum from Cerdocyon thous to L. longipalpis is low (Courtenay et al., 2002a). The low infectivity rates of C. thous may be correlated to absence of clinical signs that is usually associated with infection in this species as observed in the present case. Importantly, sympto-matic domestic dogs are more infectious to the vector than the asymptomatic ones (Courtenay et al., 2002b).
The importance of a given species as a reservoir for VL will depend on their ability to successfully transmit the parasite to sand flies rather than their infection rate, as well as on the likelihood that this species can introduce the pathogen into the domestic dog population (Courtenay et al., 2002a,b). Thus, C. thous represents little risk for dispersion of VL when compared to domestic dogs. Furthermore, the population of wild canids in urban areas is negligible when compared to that of domestic dogs. However, the possibility of translocation of infected animals from one zoo to another may eventually lead to dissemination of the disease (Figueiredo et al., 2008).result cannot be completely excluded. This animal had a pancreatic nodule, which based on histopathology and an immunohistochemical panel was diagnosed as a malignant insulinoma (Malta et al., 2008).
Several species of birds and mammals are held in captivity at the FZB, and wild and synanthropic animals
can also be found in the same area, including large populations of opossums and pigeons. The presence of these animals, especially birds, represents a risk factor for VL (Diniz et al., 2008) since the main source of nutrition for L. longipalpis is the blood from birds followed by rodents, humans, dogs, opossums, and horses (Dias et al., 2003). Domestic animals such as dogs, cats, cattle, horses, and birds can also be found around the FZB. All these factors contribute to the maintenance of the vector in the environment.
Two vertebrate reservoirs have been identified for human VL in Brazil, the domestic dog and the crabeating fox (Cerdocyon thous) (Deane and Deane, 1962; Courtenay et al., 1996). There is also a report of the occurrence of seropositivity in wild non-captive Cerdocyon thous and Chrysocyon brachyurus in the State of Minas Gerais, Brazil (Curi et al., 2006). A study based on xenodiagnosis, demonstrated that the rate of transmission of Leishmania infantum from Cerdocyon thous to L. longipalpis is low (Courtenay et al., 2002a). The low infectivity rates of C. thous may be correlated to absence of clinical signs that is usually associated with infection in this species as observed in the present case. Importantly, sympto-matic domestic dogs are more infectious to the vector than the asymptomatic ones (Courtenay et al., 2002b).
In contrast to previous reports (Courtenay et al., 2002a), some of the cases described here were associated with clinical signs of VL. Wild animalskept in captivity in endemic areas for VL have a high probability of being infected because they live longer. In addition, a long life predisposes the animal to other factors and diseases that might favor the development of VL clinical signs. For instance, stress and changes in diet and behavior are common causes influencing disease manifestation in wild animals in captivity (Frankham, 2005). The animal 2 (Lycalopex vetulus) was born at the FZB, indicating that the infection was acquired within the premises of the FZB, however this animal did not develop any clinical sign of VL.
The Brazilian control program is based on free distribution of specific drugs for human treatment, reservoir control (serological examination of domestic dogs by immunofluorescence method and euthanasia of
seropositive dogs), and the vector control based on the use of insecticide (Costa, 2001). In the case of wild
canids, other issues must be considered prior to electingeuthanasia of infected animals. For instance, there is a significant threat of extinction of some species such as Chrysocyon brachyurus and Spheotos venaticus, and there is insufficient knowledge about the potential of transmission of VL by these wild canids. However, control measures such as permanent use of collar impregnated with insecticide and spraying of pyrethroid every 3 months in the premises must be adopted in endemic areas.
Acknowledgment RLS is a recipient of a fellowship from the ‘‘Conselho Nacional de Desenvolvimento Cientı´fico e Tecnolo´gico’’ (CNPq, Brası´lia, Brazil).
References
Barata, R.A., Franc¸a-Silva, J.C., Mayrink, W., Silva, J.C., Prata, A.,
Larosa, E.S., Fiu´za, J.A., Gonc¸alves, C.M., Paula, K.M., Dias,
E.S., 2005. Aspectos da ecologia e do comportamento de flebotomı
´neos em a´rea endeˆmica de leishmaniose visceral, Minas
Gerais. Rev. Soc. Bras. Med. Trop. 38, 421–425.
Bevilacqua, P.D., Paixa˜o, H.H., Modena, C.M., Castro, M.C.P.S.,
2001. Urbanizac¸a˜o da leishmaniose visceral em Belo Horizonte.
Arq. Bras. Med. Vet. Zootec. 53, 1–8.
Costa, C.H.N., 2001. Mudanc¸as no controle da leishmaniose visceral
no Brasil. Rev. Soc. Bras. Med. Trop. 34, 223–228.
Courtenay, O., Quinnell, R.J., Garcez, L.M., Dye, C., 2002a. Low
infectiousness of a wildlife host of Leishmania infantum: the crabeating
fox is not important for transmission. Parasitology 125,
407–414.
Courtenay, O., Quinnell, R.J., Garcez, L.M., Shaw, J.J., Dye, C.,
2002b. Infectiousness in a cohort of Brazilian dogs: why culling
fails to control visceral leishmaniasis in areas of high transmission.
J. Infect. Dis. 186, 1314–1320.
Courtenay, O., Santana, E.W., Johnson, P.J., Vasconcelos, L.A.B.,
Vasconcelos, A.W., 1996. Visceral leishmaniasis in the hoary
zorro Dusicyon vetulus: a case of mistaken identity. Trans. R.
Soc. Trop. Med. Hyg. 90, 498–502.
Curi, N.H.A., Miranda, I., Talamoni, S.A., 2006. Serologic evidence
of leishmania infection in free-ranging wild and domestic canids
around a Brazilian national park. Mem. Inst. Oswaldo Cruz 101,
99–101.
Deane, L.M., Deane, M.P., 1962. Visceral leishmaniasis in Brazil.
Geographical distribution and transmission. Rev. Inst. Med. Trop.
Sa˜o Paulo 4, 49–212.
Dias, F.O.P., Lorosa, E.S., Rebeˆlo, J.M., 2003. Fonte alimentar
sangu¨ ı´nea e a peridomiciliac¸a˜o de Lutzomyia longipalpis (Lutz
& Neiva, 1912) (Psychodidae, Phlebotominae). Cad. Sau´de Pu´bl.
19, 1373–1380.
Diniz, S.A., Melo, M.S., Borges, A.M., Bueno, R., Reis, B.P., Tafuri,
W.L., Nascimento, E.F., Santos, R.L., 2005. Genital lesions associated
with visceral leishmaniasis and shedding of Leishmania sp.
in the semen of naturally infected dogs. Vet. Pathol. 42, 650–658.
Diniz, S.A., Silva, F.L., Carvalho Neta, A.V., Bueno, R., Guerra,
R.M.S.N.C., Abreu-Silva, A.L., Santos, R.L., 2008. Animal reservoirs
for visceral leishmaniasis in densely populated urban areas.
J. Infect. Dev. Countries 2, 24–33.
Figueiredo, F.B., Gremia˜o, I.D., Pereira, S.A., Fedulo, L.P., Menezes,
R.C., Balthazar, D.A., Schubach, T.M., Madeira, M.F., 2008. First
report of natural infection of a bush dog (Speothos venaticus) with
Leishmania (Leishmania) chagasi in Brazil. Trans. R. Soc. Trop.
Med. Hyg. 102, 200–201.
Frankham, R., 2005. Stress and adaptation in conservation genetics. J.
Evol. Biol. 18, 750–755.
Grimaldi Jr., G., Tesh, R.B., 1993. Leishmaniases of the New World:
current concepts and implications for the future research. Clin.
Microbiol. Rev. 6, 230–250.
Lachaud, L., Marchergui-Hammami, S., Chabbert, E., Dereure, J.,
Dedet, J.P., Bastien, P., 2002. Comparison of six PCR methods
using peripheral blood for detection of canine visceral leishmaniasis.
J. Clin. Microbiol. 40, 210–215.
Malta, M.C.C., Luppi, M.M., Oliveira, R.G., Langohr, I.M., Ecco, R.,
Santos, R.L., et al., 2008. Malignant insulinoma in a crab-eating
fox (Cerdocyon thous). Braz. J. Vet. Pathol. 1, 25–27.
Palatnik-de-Sousa, C.B., Santos, W.R., Franc¸a-Silva, J.C., Costa,
R.T., Reis, A.B., Palatnik, M., Mayrink, W., Genaro, O., 2001
Barata, R.A., Franc¸a-Silva, J.C., Mayrink, W., Silva, J.C., Prata, A.,
Larosa, E.S., Fiu´za, J.A., Gonc¸alves, C.M., Paula, K.M., Dias,
E.S., 2005. Aspectos da ecologia e do comportamento de flebotomı
´neos em a´rea endeˆmica de leishmaniose visceral, Minas
Gerais. Rev. Soc. Bras. Med. Trop. 38, 421–425.
Bevilacqua, P.D., Paixa˜o, H.H., Modena, C.M., Castro, M.C.P.S.,
2001. Urbanizac¸a˜o da leishmaniose visceral em Belo Horizonte.
Arq. Bras. Med. Vet. Zootec. 53, 1–8.
Costa, C.H.N., 2001. Mudanc¸as no controle da leishmaniose visceral
no Brasil. Rev. Soc. Bras. Med. Trop. 34, 223–228.
Courtenay, O., Quinnell, R.J., Garcez, L.M., Dye, C., 2002a. Low
infectiousness of a wildlife host of Leishmania infantum: the crabeating
fox is not important for transmission. Parasitology 125,
407–414.
Courtenay, O., Quinnell, R.J., Garcez, L.M., Shaw, J.J., Dye, C.,
2002b. Infectiousness in a cohort of Brazilian dogs: why culling
fails to control visceral leishmaniasis in areas of high transmission.
J. Infect. Dis. 186, 1314–1320.
Courtenay, O., Santana, E.W., Johnson, P.J., Vasconcelos, L.A.B.,
Vasconcelos, A.W., 1996. Visceral leishmaniasis in the hoary
zorro Dusicyon vetulus: a case of mistaken identity. Trans. R.
Soc. Trop. Med. Hyg. 90, 498–502.
Curi, N.H.A., Miranda, I., Talamoni, S.A., 2006. Serologic evidence
of leishmania infection in free-ranging wild and domestic canids
around a Brazilian national park. Mem. Inst. Oswaldo Cruz 101,
99–101.
Deane, L.M., Deane, M.P., 1962. Visceral leishmaniasis in Brazil.
Geographical distribution and transmission. Rev. Inst. Med. Trop.
Sa˜o Paulo 4, 49–212.
Dias, F.O.P., Lorosa, E.S., Rebeˆlo, J.M., 2003. Fonte alimentar
sangu¨ ı´nea e a peridomiciliac¸a˜o de Lutzomyia longipalpis (Lutz
& Neiva, 1912) (Psychodidae, Phlebotominae). Cad. Sau´de Pu´bl.
19, 1373–1380.
Diniz, S.A., Melo, M.S., Borges, A.M., Bueno, R., Reis, B.P., Tafuri,
W.L., Nascimento, E.F., Santos, R.L., 2005. Genital lesions associated
with visceral leishmaniasis and shedding of Leishmania sp.
in the semen of naturally infected dogs. Vet. Pathol. 42, 650–658.
Diniz, S.A., Silva, F.L., Carvalho Neta, A.V., Bueno, R., Guerra,
R.M.S.N.C., Abreu-Silva, A.L., Santos, R.L., 2008. Animal reservoirs
for visceral leishmaniasis in densely populated urban areas.
J. Infect. Dev. Countries 2, 24–33.
Figueiredo, F.B., Gremia˜o, I.D., Pereira, S.A., Fedulo, L.P., Menezes,
R.C., Balthazar, D.A., Schubach, T.M., Madeira, M.F., 2008. First
report of natural infection of a bush dog (Speothos venaticus) with
Leishmania (Leishmania) chagasi in Brazil. Trans. R. Soc. Trop.
Med. Hyg. 102, 200–201.
Frankham, R., 2005. Stress and adaptation in conservation genetics. J.
Evol. Biol. 18, 750–755.
Grimaldi Jr., G., Tesh, R.B., 1993. Leishmaniases of the New World:
current concepts and implications for the future research. Clin.
Microbiol. Rev. 6, 230–250.
Lachaud, L., Marchergui-Hammami, S., Chabbert, E., Dereure, J.,
Dedet, J.P., Bastien, P., 2002. Comparison of six PCR methods
using peripheral blood for detection of canine visceral leishmaniasis.
J. Clin. Microbiol. 40, 210–215.
Malta, M.C.C., Luppi, M.M., Oliveira, R.G., Langohr, I.M., Ecco, R.,
Santos, R.L., et al., 2008. Malignant insulinoma in a crab-eating
fox (Cerdocyon thous). Braz. J. Vet. Pathol. 1, 25–27.
Palatnik-de-Sousa, C.B., Santos, W.R., Franc¸a-Silva, J.C., Costa,
R.T., Reis, A.B., Palatnik, M., Mayrink, W., Genaro, O., 2001
Impact of canine control on the epidemiology of canine and
human visceral leishmaniasis in Brazil. Am. J. Trop. Med. Hyg.
65, 510–517.
Patz, J.A., Graczyk, T.K., Geller, N., Vittor, A.Y., 2000. Effects of
environmental change on emerging parasitic diseases. Int. J.
Parasitol. 30, 1395–1405.
Sherlock, I.A., 1996. Ecological interactions of visceral leishmaniasis
in the state of Bahia, Brazil. Mem. Inst. Oswaldo Cruz 91, 671–
683.
Silva, E.S., Gontijo, C.M.F., Pacheco, R.S., Fiuza, V.O.P., Brazil, R.P.,
2001. Visceral leishmaniasis in metropolitan region of Belo
Horizonte state of Minas Gerais, Brazil. Mem. Inst. Oswaldo
Cruz 96, 285–291.
Tafuri, W.L., Santos, R.L., Arantes, R.M.E., Gonc¸alves, R., Melo,
M.N., Michalick, M.S.M., Tafuri, W.L., 2004. An alternative
immunohistochemical method for detecting Leishmania amastigotes
in paraffin-embedded canine tissues. J. Immunol. Methods
292, 17–23
human visceral leishmaniasis in Brazil. Am. J. Trop. Med. Hyg.
65, 510–517.
Patz, J.A., Graczyk, T.K., Geller, N., Vittor, A.Y., 2000. Effects of
environmental change on emerging parasitic diseases. Int. J.
Parasitol. 30, 1395–1405.
Sherlock, I.A., 1996. Ecological interactions of visceral leishmaniasis
in the state of Bahia, Brazil. Mem. Inst. Oswaldo Cruz 91, 671–
683.
Silva, E.S., Gontijo, C.M.F., Pacheco, R.S., Fiuza, V.O.P., Brazil, R.P.,
2001. Visceral leishmaniasis in metropolitan region of Belo
Horizonte state of Minas Gerais, Brazil. Mem. Inst. Oswaldo
Cruz 96, 285–291.
Tafuri, W.L., Santos, R.L., Arantes, R.M.E., Gonc¸alves, R., Melo,
M.N., Michalick, M.S.M., Tafuri, W.L., 2004. An alternative
immunohistochemical method for detecting Leishmania amastigotes
in paraffin-embedded canine tissues. J. Immunol. Methods
292, 17–23
M.M. Luppi et al. / Veterinary Parasitology 155 (2008) 146–151
